coliyadavis6790 coliyadavis6790

04-04-2020
Biology

contestada

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.

Respuesta :

luisvaschetto luisvaschetto

04-04-2020

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

Answer Link

Otras preguntas

Based on their actions in "The Fiery Furnace," what is the best description of Shadrach, Meshach, and Abednego? A. They are compassionate and gentle to all

Find the approximate area of a circle with radius equal to 8 ft.

Agree or disagree"the prosperity of the"boom years",led to the extravagant lifestyles for the wealthy which eventually led to the collapse of the wall street st

The greater the mass is in an object, the higher resistance to a change in movement the object will have. Please select the best answer from the choices provide

what has photographer lee friedlander tried to show through his photographs of television screens

What has been a lasting impact of European colonialism? Artificial boundaries created by colonial rulers brought together and separated people arbitrarily Diffi

A skier has decided that on each trip down a slope, she will do 3 more jumps than before. On her first trip she did 5 jumps. Derive the sigma notation that show

Which term best describes journalists who worked to expose abuses of corporate power, thereby gathering public support for regulation and reform, during the Pro

a sample of food containing one type of a large molecule was treated with a specific digestive enzyme . nutrient test performed on the resulting products showed

-5×-4=? a)1 b)-1 c)20 d)-20