michmunoz michmunoz

03-05-2021
Mathematics

contestada

A quadrilateral ABCD is drawn on a coordinate plane. Find the length of the side AB.

A quadrilateral ABCD is drawn on a coordinate plane Find the length of the side AB class=

Respuesta :

Jbare1111 Jbare1111

03-05-2021

Answer:

its A i think

Step-by-step explanation:

Answer Link

rickmork1 rickmork1

03-05-2021

Answer:

45 units

Step-by-step explanation:

Answer Link

Otras preguntas

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

I’m confused need help please

In the story marching to different drummers it's asking with which statement would the author most likely agree?

Given that f (x)=x^3−4x and g ( x)=-2x-4, find the zeros. I WILL CALL THE BRAINLEST

What was the result of the FIRST Continental Congress

What is the text structure of the passage ? A. Descriptive B. Chronological order C.Problem and solution D. Cause and effect

Kelly wants to plant flowers on the edge of a circular flowerbed around a tree. If the radius of the flowerbed is 2 feet, and she wants to place the plants app

1 + (-2/3) - (-m) where m = 9/2

Maria weighs 55 kilograms. What is her weight in pounds?

If Carla runs across the park along the diagonal instead of along the streets, how many yards of running will she save?