8473089 8473089

04-05-2021
English

contestada

May 7th is National Nurses Appreciation Day. Nurses work in a variety of medical fields and handle everything from surgery assistance to medical drug distribution. What do you think are the benefits and difficulties of being a nurse? If you could be a nurse, what area of medicine would you want to work in? Why?

Respuesta :

NatsFood NatsFood

04-05-2021

Answer:

Labor and Delivery Nurse because babies are cute.

Explanation:

I don't know.

Answer Link

maddy031 maddy031

04-05-2021

I would be a pediatric nurse , only because I love working with kids & babies and I feel as if it is easier for me

Answer Link

Otras preguntas

I just need a confirmation that my answer is right? Find side AC. Round to the nearest hundredth. The angles are: Angle A = 40°, Angle C = 90°, and Angle B = 50

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A box contains 3 plain pencils and 5 pens. A second box contains 6 color pencils and 2 crayons. One item from each box is chosen at random. What is the probabil

an integer is one more than four times another. if the product of two integers is 39, then find the integers

Mark bought a set of 6 flower pots of different sizes at a total cost of $8.25. each pot cost $0.25 more than the next one below it in size. what was the cost,

Judith has recently been diagnosed with cancer. her quality of life is now poor because her coping style is one of helplessness and she has problems expressing

Write each statement as an algebraic expression. Twice the difference of x and y divided by 5 times their product.

How did the triple alliance and the triple entente change during the war?

What are the different ways of interpreting the title of the short story was it a dream

How many significant figures are there is the numerical value: 0.00019?