02-02-2017
Mathematics

contestada

Please solve 9y-4-11y+7

Respuesta :

httplyiah httplyiah

02-02-2017

your answer will be -2y+3

9y-11y= -2

-4+7=3

Answer Link

Otras preguntas

Given R 008211am mol K how many moles of gas are in a 125 L container at 300K and 2.07 atm? (1 point) 0.105 mol 0.067 mol 0.084 mol 9.51 mol

state the factors on which strength on a material depends.

speed and velocity are same because... speed and velocity are different because...

What must never happened to atoms during a chemical reaction

you can get 20 point for awnsering this question and i will mark brainliest if answered correctly How is success of intrest groups measured A) weather the gover

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Find the value of n Thank you

If f(x) = 2x – 6 and g(x) = x – 22, find each value. g(–1) a.–8 b.–1 c.1 d.–3

Why does the formula divide by n - 1? Psychology

Which type of space technology collects data like the samples shown here? A. Probes B. Telescopes C. Rovers D. Satellites